multiple cloning sites Search Results


90
Taihe Biotechnology Co Ltd polynucleotide containing multiple cloning sites and fragments corresponding to amino acid polylinkers
Polynucleotide Containing Multiple Cloning Sites And Fragments Corresponding To Amino Acid Polylinkers, supplied by Taihe Biotechnology Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polynucleotide containing multiple cloning sites and fragments corresponding to amino acid polylinkers/product/Taihe Biotechnology Co Ltd
Average 90 stars, based on 1 article reviews
polynucleotide containing multiple cloning sites and fragments corresponding to amino acid polylinkers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Oligos Etc multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)
Multiple Cloning Site Oligos 5′Aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (Seq Id No: 18), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)/product/Oligos Etc
Average 90 stars, based on 1 article reviews
multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Promega palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab)
Palter Ab 3.2 Kb Hind Iii Kpni Fragment Containing Arsab Genes Cloned Into The Multiple Cloning Site Of Palter™21, (Arsab), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab)/product/Promega
Average 90 stars, based on 1 article reviews
palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Promega multiple cloning site
Multiple Cloning Site, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site/product/Promega
Average 90 stars, based on 1 article reviews
multiple cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Promega flag tag and part of the multiple cloning site
Flag Tag And Part Of The Multiple Cloning Site, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/flag tag and part of the multiple cloning site/product/Promega
Average 90 stars, based on 1 article reviews
flag tag and part of the multiple cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation dna fragment encoding mmbp and a multiple cloning site
Dna Fragment Encoding Mmbp And A Multiple Cloning Site, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna fragment encoding mmbp and a multiple cloning site/product/GenScript corporation
Average 90 stars, based on 1 article reviews
dna fragment encoding mmbp and a multiple cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Oligos Etc multiple cloning site
Multiple Cloning Site, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site/product/Oligos Etc
Average 90 stars, based on 1 article reviews
multiple cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
5 PRIME multiple cloning site (mcs)
Multiple Cloning Site (Mcs), supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site (mcs)/product/5 PRIME
Average 90 stars, based on 1 article reviews
multiple cloning site (mcs) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Clonexpress inc multiple cloning site (mcs) 1
Multiple Cloning Site (Mcs) 1, supplied by Clonexpress inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site (mcs) 1/product/Clonexpress inc
Average 90 stars, based on 1 article reviews
multiple cloning site (mcs) 1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Mobitec Inc portion of the multiple cloning site
Portion Of The Multiple Cloning Site, supplied by Mobitec Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/portion of the multiple cloning site/product/Mobitec Inc
Average 90 stars, based on 1 article reviews
portion of the multiple cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Twist Bioscience pucx multiple cloning site
Pucx Multiple Cloning Site, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pucx multiple cloning site/product/Twist Bioscience
Average 90 stars, based on 1 article reviews
pucx multiple cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
5 PRIME pds132 multiple cloning site
Pds132 Multiple Cloning Site, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pds132 multiple cloning site/product/5 PRIME
Average 90 stars, based on 1 article reviews
pds132 multiple cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results